Proteins are essential players of all biological processes and they are involved in practically every function performed by a living cell.
The present project aims to synthesize the ancestral catalytic domain of PTPs as corresponding to the derived sequence, to characterize it by a multitude of in vivo and in vitro procedures and to offer in this way new information regarding the evolution of the PTPs and their role in the ancient world.
We expect that the sequence of the ancestor PTP together with its enzyme kinetic characteristics, in vitro and in vivo substrate specificity profiles will have a major impact on understanding how PTPs evolved from an ancestral form to the existing representatives.
Head of Department
Professor Dr. Stefan Eugen Szedlacsek is the Head of the Enzymology Department at the Institute of Biochemistry of the Romanian Academy. He holds a PhD degree in Biotechnology from Polytechnic University of Bucharest as well as a MSc in Organic Synthesis (Polytechnic University- Bucharest) and MSc in Mathematics (Bucharest University). As a visiting scientist, he performed research in the field of cholesterol metabolism University of Illinois at Urbana-Champaign (USA), where he succeeded to evidence a new pathway in the metabolism of oxysterols. He is an “Alexander von Humboldt“ fellow and worked in Germany, in the Institute of Biochemistry (Kiel University) More...
1.Synthesis of an ancestor of receptor protein tyrosine phosphatase catalytic domain (PTPAD1). Preparation of mutant and truncated forms of PTP-AD1
2.Enzyme kinetic characterization of PTP-AD1 and derived forms on a synthetic PTP substrate.
3.Evaluation of substrate specificity of PTP-AD1 and its derived forms using microarray profiling on pTyr-containing peptides.
4.Evaluation of catalytic efficiency and substrate specificity of PTP-AD1 and its derived forms on cellular pTyr-containing proteins.
Dr.Stefan Szedlacsek, Romanian Head of Project
Postdoctoral researcher: Mihaela Mențel
Postdoctoral researcher: Georgiana Petrăreanu
PhD Student: Rodica Badea
Msc: Aura Ionescu
Student: Ioana Iancu
1. The sequence of the catalytic domain of the ancestral protein tyrosine phosphatase (PTP-AD1) was synthesized, cloned into a prokaryotic expression vector, finally obtaining the corresponding protein.
2. Dephosphorylation of phosphoproteins in cell lysates by PTP-AD1:
Figure 1. Activity of PTP-AD1 and its forms on phosphoproteins from HEK293T cells treated with pervanadate. The presence of phosphorylated proteins was detected by immunoblotting (top image). Anti-calnexin and anti-GST antibodies were used to control the amount of total protein in the cell lysate and the amount of enzyme (GST-AD1) added to the reaction, respectively.
3. Obtaining EGFP-PTP-AD1 constructs.
PTP-AD1 sequences (AD1, AD1-CVL, AD1-C220S, and AD1-N/K) were subcloned into the pEGFP-N1 expression vector. The corresponding sequences were amplified by PCR (Table 1), using the primers:
PTP-AD1-N1-for: CCGCTCGAGATGATCCCGGTCAAAGTGGAAGAC
PTP-AD1-N1-rev: GCGGGATCCGCGTCCATGTTGGTGTGGGTATTATGC
PTP-CVL-N1-rev: GCGGGATCCGCCAAAACGCACTGATGGAGGAAAAC
The DNA fragments obtained were subjected to restriction with the enzymes XhoI and BamHI and inserted between the same sites of the eukaryotic expression vector pEGFP-N1, previously subjected to restriction with the 2 enzymes.
Five clones for each construct were restriction analyzed with the same enzymes to verify that they had the appropriate DNA insert.
The DNA sequence was also confirmed by sequencing for 2 of the positive clones obtained.
Published papers:
1. WDR1 is a novel EYA3 substrate and its dephosphorylation induces modifications of the cellular actin cytoskeleton: Mentel M, Ionescu AE, Puscalau-Girtu I, Helm MS, Badea RA, Rizzoli SO, Szedlacsek SE. Sci Rep. 8, 2910; 2018; https://pubmed.ncbi.nlm.nih.gov/29440662/
Romanian Academy